Query (optional)   in Class  

GrainGenes Probe Report: CFT5008

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
CFT5008
Locus
cft5008
cft5008-3B
Reference
ReferenceGraziani, M (2012) Mappaggio fine di un QTL principale per la resa in granella sul cromosoma 3B di frumento duro Dissertation - Universita di Bologna 1-202.
General Remarks
Annealing temp = 61 - 51, Allele size = 174
Type
PCR
PCR primers
GTCTTGGGTCAATCCGTTTG
TGTGTGTGTGTGGGGG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.