Query (optional)   in Class  

GrainGenes Probe Report: CFT5036

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFT5036
Locus
cft5036
cft5036-3B
Reference
ReferenceGraziani, M (2012) Mappaggio fine di un QTL principale per la resa in granella sul cromosoma 3B di frumento duro Dissertation - Universita di Bologna 1-202.
Type
PCR
PCR primers
GAAGAAAGGCATGACGATCC
ATTTACCATGAAGGCGCAAC