Query (optional)   in Class  

GrainGenes Probe Report: CV776265-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CV776265-1A
Data at Wheat_SNP
CV776265-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;DEL at 183;626
SNP G>A;G>A;DEL at 183;475;626
Reference sequence TTTGTGCATCATGGTCCAAGTAAGCCTTTCTCTTCTAATTTGTTCTGCAAGCTTGATGAAAGTGGCTTATGATTGAGATGTGGCGTTGGAAAGCAAGTGAGATGTAGAAGTACAGGTTGGTGCATTGAAGTCTGGTGCAATTTGGTGCTGCCAGATTCTGGGTTGATTATGTCAAAAATGATGAATAAAACTATTAGTCTTGAGATCTTTGCCTCTTAACTAACATTCTGTGATTCTTTTCTCTGATAAGAAAACAGAGGTCACTGAGGCAGGAAAAAACAGAGTAGTGCTCCTCTTATATTAGCTTTATGCAATACATGAGATATAAGCCTCACCTGCTCATTGTGGCCATAGGCCATTCTCTGTTCCATTCGTTGGCAAATAACACTGAATGCACTTGAACAATCCTTAGGAATCTGTGTCTCCTCATGCAGCCCCAAGAACCTAGCAGACGTAAGAGCAATTATGTGATTTGTCAGTTCTAACACAGAATTTCAGAAGCATTGATGGTTGTTCCTAACACACTCTTAAATTATTTCTTGCAATAGTAGTCACTGCATATATATTAGGGGACATGATCAAAATGGTACTAAAACGGTTTGTACAAGAGATGGAATTTGAAAACTAATGGCATAACTCATAGAGCACAGAGGATCAGAAACTAACTTGATTGTTTTGAGTATCTTGACAGCTAGTTCCTTTTCTTTGCAATGCCCAAGCATCATGAGTCTTGAAACCAGTTCATCATCATGTCCTCCAGACTCTTCACCGTATATCTTTGTG
Type
EST
SNP
PCR primers
CV776265_cpR1 TTCATGGTGGAGCAGTACCATATC
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01