Query (optional)   in Class  

GrainGenes Probe Report: CV776265-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
CV776265-1B
Data at Wheat_SNP
CV776265-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 316,4
SNP A>T at 355
SNP DEL at 321-327
Reference sequence TTCAGGGTTATTTGCCAATGTATGGAACAGAGAATGGCCTATGGCCACAATGAGCAGGTGAGACTTAATATCTTTCATCGTCGTTCTGTCTCATGTATTGCATATAACTATTGAAATTATTCTTGTACAAACAATATAACAGAAGCACTACTCTGTTTTTTCCTGCCTCTGTGACCTCTGTTTTCTTATCAGAGAAGAGAATCACATAATGTTACTTAAGAGGCAAAGATCTCAAGAGTAATAGTTTTATTTATCATTTTTTGACATAATCAACTGTGAATCTGGCAGCACCAAAGTTCACGCGCAGAGACTTATTAGTATTGTAGTAGATTGACAGTTTAATGACCAACCTGTACTTCTACATCTCACATTGCTTTCCAACACCATATGTCAATCATAAACAGGCTTGCAGAATAAATTAAAAGAGACTGGCTTACTTGGACCATGACGAGCTAAAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01