Query (optional)   in Class  

GrainGenes Probe Report: CV776265-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CV776265-1D
Data at Wheat_SNP
CV776265-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A at 569
SNP A>C at 501
Reference sequence CCTCCCTTGGATGTCAACAATGTTATCCACATCTAACACAAAGGTAAATGGTGAAGAAACTGGAGGACATGATGATGAACTGATTTCAAGACTCATGATGCTTGGGCATTGCAAAGAAAAGGAACTAGCTGTCAAGATACTCAAAACCATCAAGTTAGTTTCTGATCCCTATACTTTATGGGTCCCAATTGCATCTCTTCTACAGACTGCTTAAGTACCATTTTAATCATGTCATATAATATATGTTCAATGACTACGATTGCAAGAAATAATTTAAGAATATGTTAGGGACGATCAGCATTGCTTCTGAAATTCGCGGTTAGAACTGACGAATCACTTAACTGGTCTTTACACCTGGTAGGTTCTTGGGGCTGCATGAGGAGACACAGATTCCTAAGGATTGTTCAAGTGCATTCACTGTTATTTGCCAACGAATGGAACAGAGAATGGCCTATGGCCACAATGAGCAGGTGAGACTTATTATCTTTCATCGTCGTTATACCTCATGTATATTGCATATAGCTATTGAAATTATTCTTGTACAAACAATATAACAGAAGCACTACTCTGTTTTTTCCTGCCTCTGTGGCCTCTGTTTTCTTATCAGAGAAGAGAATCACATAATGTTACTTAAGAGGCAAATATCTCAAAAGTAATAGTTTTTACTTATCATTTTTGACATAATCAACTGTTAATCTGGCAGCACCAAATTTCATACGCAGACTCTTATTAGTGTTGTAGTAGATTGACAGTTTGATGACCAGCCTGTACTTCTACATCTCACATTGCTTTCCAACACCATATCTCAATCATAAACAGGCTTGCAGAATAAATTAAAAGAGACTGGGCTTACTCGGACCA
Type
EST
SNP
PCR primers
CV776265_cpR2 TACTCCACCTCGACTTCATGGT
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01