Query (optional)   in Class  

GrainGenes Probe Report: CWEM1

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
CWEM1  [ Marker Report ]
Locus
Xcwem1a
[ Show all 7 ]
General Remarks
SSR motif: (CAG)5
Type
PCR
SSR
EST
PCR primers
Left CCGTCGTCAGTTCAAATGG
Right TCCAGGAATGGGTTTACTGC
Amplification Conditions
Annealing temperature 50
Sequence
BF200929
Data Source
Peng, Junhua2005.05

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.