Query (optional)   in Class  

GrainGenes Probe Report: CWEM56

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM56  [ Marker Report ]
Locus
Xcwem56a
Xcwem56b
Xcwem56c
General Remarks
SSR motif: (CCG)6
Type
PCR
SSR
EST
PCR primers
Left CCAAGTGTCAGCAACAAGCA
Right TAGACGAACACGCTGTGGTG
Amplification Conditions
Annealing temperature 55
Sequence
BE425936
Data Source
Peng, Junhua2005.05