Query (optional)   in Class  

GrainGenes Probe Report: CWM106

Probe
CWM106
Reference
ReferenceGao LF et al. (2003) Analysis of microsatellites in major crops assessed by computational and experimental approaches Molecular Breeding 12:245-261.
General Remarks
Repeat motif: A
In a survey of 40 wheat varieties, 173 of 478 CWM EST-SSRs were polymorphic.
Type
PCR
SSR
EST
PCR primers
GTGTGCGCTCCATGTGTAAAT
CGGCGGCAGCAGGGAAGTT
Amplification Conditions
Annealing temperature 50 oC
Source Species
Triticum aestivum