Query (optional)   in Class  

GrainGenes Probe Report: CWM163

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWM163
Reference
ReferenceFu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038.
ReferenceGao LF et al. (2003) Analysis of microsatellites in major crops assessed by computational and experimental approaches Molecular Breeding 12:245-261.
General Remarks
Repeat motif: AAC
In a survey of 40 wheat varieties, 173 of 478 CWM EST-SSRs were polymorphic.
In 369 Avena sterilis accessions there were 2 alleles of size 54-75 bp, PIC = 0.01.
Repeat sequence (AAC)14
Type
PCR
SSR
EST
PCR primers
TTTCTCATCCTTGCCCTCGTG
CCTGGAAATTGTTGTTGTTGTA
Amplification Conditions
Annealing temperature 55 oC
Source Species
Triticum aestivum
Data Source
Fu, Yong-Bi2007.04