Query (optional)   in Class  

GrainGenes Probe Report: DR734151-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
DR734151-6A
Data at Wheat_SNP
DR734151-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 752,1
SNP T>C;A>T at 652;767
SNP T>C at 652
Reference sequence TCTGAAGATTTCTACATGTGTCTTTTTGACCAACTTTATTTGGTTCAGACCAGGAAGTTTAGAAATTCACTTAAACACAGGCAGAAAGACAGATGGACTTACTCCCATGGGTCATCGCCGAGAAGTAGGACGTCGTCCTCATGATCTGTGTAGACTAGCTTCCAACCTATTCTCTGTCGGTCTTCAAGTTGCCCCTCTATACCAAACATGCGGGCCAAAGCTTGGTTCAGTTCTCCATATCCAGAGAACCTACCGATGTCAATGGACCGGCCTACAGCTCCACGCTTGTACACCTACAAGACACAGTTTAAGCTAAGATACAGGGGAAGCATACAACAAGGAAAGCATACTAATGAGCATGGCCATACGAGGGCCGGCATTTCCAACTGACCCTTCAACAAGCTTTTAGAGCTCTATGTGCCTATGTGTGACCATCTTCTCATCCACTACACATAGAAGTGTTGTCTTACAACATATATCTCATGCAATCAGTTCTTATCTGAACCATCAACCACCATTTCGAACATTACTACATACAGAATGTAAAATTTTATCTTGGTAAAAAAACTGTAACTTTGCTAAACTATAATTGTTGTTGGTGCATTCCTTTCTTAAAACTTTTTTAAAGGCAATTGCAATGACATTATTTTATAACTAGCTGCTGGATCATAACTTAGTTTTGAGATGGTCATGTTCTTAAAATATCTCAGTGGAGTAATTTTACTATTTGGTAATATAGGCACCACACAACATATACTGCCTTAAAAATCGACT
Type
EST
SNP
PCR primers
DR734151A_F1 GATCCTGTTTCACATTTCTGAAG
DR734151A_R1 GTGCTTATCCTATTGAAAGTCG
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01