Query (optional)   in Class  

GrainGenes Probe Report: DR734151-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
DR734151-6B
Data at Wheat_SNP
DR734151-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;C>G;G>A at 18;36;714
SNP G>C;G>A at 36;714
SNP G>C;G>A;G>A;G>A at 36;703;714;765
Reference sequence TTTATTTGGTTCAGACCGGGAAGTTTAGAAATTCAGTTAAACACAGGCAGAAAGGCAGATGGACTTACTCCCATGGGTCATCGCCGAGAAGTAGGACGTCATCCTCATGATCTGTGTAGACTAGCTTCCAACCGATTCTCTGTCGGTCTTCAAGTTGCCCCTCTATACCAAACATGCGGGCCAAAGCTTGATTCAGTTCTCCATATCCAGAGAACCTACCGATGTCAATGGACCGGCCTACAGCTCCACGCTTGTACACCTACAAGACACAGTTTAAGCTAAGATACAAAAGGGGAAGCATACAACAAAGAAAGCATACTCTCAAGAGAATATGGCTCCATAATGAGCATGGCCATACGAGGGCCCTGATTTCCAACTAACCCTTTAACAAGCTTTTAAAGCTCTATGTGCCTATGTGTGACCATCTCATCCACTACACATAGAAGTGTTGTCTTACAACATATATCTCATGCAATCAGTTCTTATCTGAACCATCAACCACCATTTCAAACATTATTACATACAGAATGTAAAAATTATATTGGTAAAAAACTGTAACTTTGCTAAACTACAATTGTTGTTGTGTGCATTCCTTTTTTAAAACTTTTTTACAGGCAATTGCAATGACATTATTTTATAACTAGCTGCTGGATCATAACTTAGTTTTGAGATGGTCATGTTCTTAAAATATCTCAGTGGAGGGGCTTCATTTTGCTACTATTTGGTAATATAGGCACCACACGACATATACTGCCTTAAAAATCGTACTTTCAATAGGATAAGCACATAACAGAAAAAGGAAAACCTTGGTGAATGTACGCATCCTCTGTGGTGGAGCAGCAGGAGGCCAAGAACTTCTGTTCATTAAGGCACCATCATTAATTGCAGAATCGATGGAATTAAAAGCCATATCTGATTGACCAAATGACTGTGAAACCATGGAGGTTGATATCTCTTGACGGGCATCCTT
Type
EST
SNP
PCR primers
DR734151B_F1 GATCCCGTTTCACATTTCTTAAC
DR734151_cpR1 GCACTTGATTCTGTGAAGTATC
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01