Query (optional)   in Class  

GrainGenes Probe Report: DR734151-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
DR734151-6D
Data at Wheat_SNP
DR734151-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>T;G>C at 410;473;520
SNP C>T;A>G at 414;567
SNP A>G at 567
Reference sequence CTATTTCACATTTCTAGACATTTCTACATGTGTCCTTTTGACAAACTATATTTGGTTCAGACTGGGAAGTTTAGAAATTCACTTAAACACAGGCAGAAAGGCAGATGGACTTACTCCCATGGGTCATCGCCGAGAAGTAGGACGTCATCCTCATGATCTGTGTAGACTAGCTTCCAACCTATTCTCTGTCGGTCTTCAAGTTGCCCCTCTATACCAAACATGCGGGCCAAAGCTTGATTCAGTTCTCCATATCCAGAGAACCTACCGATGTCAATGGACCGGCCTACAGCTCCACGCTTGTACACCTACAAGACACAGTTTAAGCTAAGATACAAAAGGGGGAAGCATACAACAAAGAAAGCATACTCTCAAGAGAATATGGCTCCATAATGAGCATGGGCATACGAGGGCCCCGATTTCCAACTGACCCTTTAACAAGCTTTTAGAGCTCTTATGTGCCTATGTGTGACCACCTCATCCACTACACATAGAAGTGTCATCTTACAACATATATCTCATGCAATCAGTTCTTATCTGAACCATCAACCACCATTTCGAACATTATTACATACAGAATGTAAAATTTATCTTGGTAAAAAACTGTAACTTTGCTAAACTATAATTGTTGTTGGTGTATTCCTTTTTTAAAACTTTTTTACAGGCAATTGCATTGACATTATTTTATAACTAGTTGCTGGATCATAACTTAGTTTTGAGATAGTCATGTTCTTAAATATCTCAGTGGAGGGGCTTAATTTTACTATTTGGTAATATAGGCACCACACAACATATACTGCCTTAAAAATCGT
Type
EST
SNP
PCR primers
DR734151D_F1 CAGTGTCCTGGATTGATCCTA
DR734151D_R1 GTGCTTATCCTATTGAAAGAACG
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01