Query (optional)   in Class  

GrainGenes Probe Report: DUPW167

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
DUPW167  [ Marker Report ]
Locus
XDuPw167
Xdupw167-6A
dupw167
dupw167-6A
Xdupw167
Reference
ReferenceEujayl I et al. (2002) Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat Theoretical and Applied Genetics 104:399-407.
Type
SSR
EST
PCR primers
5' CGGAGCAAGGACGATAGG
3' CACCACACCAATCAGGAACC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.