Query (optional)   in Class  

GrainGenes Probe Report: DUPW216

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
DUPW216
Locus
dupw216
dupw216-6B
Reference
ReferenceEujayl I et al. (2002) Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat Theoretical and Applied Genetics 104:399-407.
Type
SSR
EST
PCR primers
5' ACAAACCTCTCCCTCTCACG
3' ATGATGATTCAGCGAGTCGG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.