Query (optional)   in Class  

GrainGenes Probe Report: Dhn3

[ Printable Version ]  [ Submit comment/correction ]

Probe
Dhn3  [ Marker Report ]
Locus
XDhn3,4
Xucr.Dhn3,4
Dhn3
Synonym
Other nameB17
Reference
ReferenceChoi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
ReferenceClose TJ et al. (1989) A cDNA-based comparison of dehydration-induced proteins (dehydrins) in barley and corn. Plant Molecular Biology 13:95-108.
General Remarks
Barley dehydrin gene 3
Size in Dicktoo (bp) = 104
Size in Morex (bp) = 65
B17-dehydrin
Type
cDNA
PCR
STS
PCR primers
5' AGGCAACCAAGATCAACACCACCTG
3' GCGGAAGTTTTACTGCATCTCCATC
Amplification Conditions
Annealing temp. = 62
Linkage Group
Group 6
Source Gene Class
16.2 kDa dehydrin
Source Gene
Dhn3 (Hordeum)
Source Species
Hordeum vulgare
Insert Size
0.812
Clone Vector
pUC
Clone Authority
Close, Timothy J.
Data Source
ATMI92.09
Information Source
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..