Query (optional)   in Class  

GrainGenes Probe Report: Dhn5

[ Printable Version ]  [ Submit comment/correction ]

Probe
Dhn5  [ Marker Report ]
Locus
Xcsb112(Dhn5)-6A
[ Show all 16 ]
Synonym
Other nameHV5
pHv5
Reference
ReferenceChoi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
ReferenceClose TJ et al. (1989) A cDNA-based comparison of dehydration-induced proteins (dehydrins) in barley and corn. Plant Molecular Biology 13:95-108.
General Remarks
Size in Dicktoo (bp) = 1157
Size in Morex (bp) = 1449
Type
cDNA
PCR
STS
PCR primers
5' AGCAGCGCTTGTAGATATTCCCGA
3' CTCCACCAACGAAAGTGAGCTAGG
Amplification Conditions
Annealing temp. = 62
Sequence
M95810
Source Gene Class
Dehydrin
Source Species
Hordeum vulgare
Clone Location
Close, Timothy J.
Information Source
ReferenceChen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.