Query (optional)   in Class  

GrainGenes Probe Report: Dreb-B1

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Dreb-B1
Locus
Dreb-B1
Dreb
Reference
ReferenceMohamed EA et al. (2023) Screening Spring Wheat Genotypes for TaDreb-B1 and Fehw3 Genes under Severe Drought Stress at the Germination Stage Using KASP Technology Genes 14.
ReferenceUr Rehman S et al. (2021) Development and Exploitation of KASP Assays for Genes Underpinning Drought Tolerance Among Wheat Cultivars From Pakistan. Frontiers in Genetics 12.
ReferenceRasheed A et al. (2016) Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics 129:1843-60.
ReferenceWei B et al. (2009) Dreb1 genes in wheat (Triticum aestivum L.): development of functional markers and gene mapping based on SNPs Molecular Breeding 23:13-22.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.
Type
KASP
PCR primers
5' P18F: CCCAACCCAAGTGATAATAATCT 3'
5' P18R: TTGTGCTCCTCATGGGTACTT 3'
PCR primers
FAM 5' CCTGCGCACTTTCTTCTTCCTGT
[ Show all 6 ]
Source Gene
Dreb (Triticum)
Dreb-B1 (Triticum)
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.