Query (optional)   in Class  

GrainGenes Probe Report: EBmac788

[ Printable Version ]  [ Submit comment/correction ]

Probe
EBmac788  [ Marker Report ]
Locus
Ebmac0788
EBmac788
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (TG)23
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.76
Type
PCR
SSR
PCR primers
5' TAACTTACTTTATATCCATGGCA 3'
5' ATGATGAGAACTCTTCACCC 3'
TAACTTACTTTATATCCATGGCA
ATGATGAGAACTCTTCACCC
SSR size
168
Amplification Conditions
1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare