Query (optional)   in Class  

GrainGenes Probe Report: Ebmac0788

[ Printable Version ]  [ Submit comment/correction ]

Probe
Ebmac0788  [ Marker Report ]
Locus
Ebmac0788
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
TAACTTACTTTATATCCATGGCA
ATGATGAGAACTCTTCACCC