Query (optional)   in Class  

GrainGenes Probe Report: Excalibur_c100336_106_KASP

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Excalibur_c100336_106_KASP
Locus
Excalibur_c100336_106
IWB21502
Reference
ReferenceLiu G et al. (2023) Identification of KASP markers and candidate genes for drought tolerance in wheat using 90K SNP array genotyping of near-isogenic lines targeting a 4BS quantitative trait locus Theoretical and Applied Genetics 136.
Type
KASP
PCR primers
Primer_AlleleX (5'-3') GAAGGTGACCAAGTTCATGCTGCCTACACACCGCACTCA
Primer_AlleleY (5'-3') GAAGGTCGGAGTCAACGGATTGCCTACACACCGCACTCG
Primer_Common (5'-3') TGCGTTATAGTTTCATATGTTGAGC
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.