Query (optional)   in Class  

GrainGenes Probe Report: GBM1092

Probe
GBM1092  [ Marker Report ]
Locus
GBM1092
GBM1092-1H
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks
Clone HF01I06T
Type
SSR
PCR primers
Forward GGCAAGAAATCAAGAATCCG
Reverse TATCATCAACCCGGTCCAGT
GGCAAGAAATCAAGAATCCG
TATCATCAACCCGGTCCAGT
Amplification Conditions
3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
BQ464159
DNA Library
IPK-HF
Source Species
Hordeum vulgare
Source Germplasm
Barke (barley)
Data Source
Stein, Nils2006.10