Query (optional)   in Class  

GrainGenes Probe Report: GBM1094

[ Printable Version ]  [ Submit comment/correction ]

Probe
GBM1094  [ Marker Report ]
Locus
GBM1094
GBM1094-3H
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks
Primer sequences for this SSR to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Clone HF01O14w
Type
SSR
PCR primers
GGTATAATCGGCAGAAGCCA
GAGGTCACAAGCTCTACGCC
Amplification Conditions
3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
BQ659846
DNA Library
IPK-HF
Source Species
Hordeum vulgare
Source Germplasm
Barke (barley)
Data Source
Graner, Andreas
Stein, Nils2006.10