Query (optional)   in Class  

GrainGenes Probe Report: GBM1226

[ Printable Version ]  [ Submit comment/correction ]

Probe
GBM1226  [ Marker Report ]
Locus
GBM1226
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks
Primer sequences for this Microsatellite to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Type
PCR
SSR
PCR primers
CGTTCCCACTTGGAAATTGA
GTGACGGAAGGCAGAGTAGG
Source Species
Hordeum vulgare
Data Source
Graner, Andreas