GrainGenes Probe Report: GBM1270
[Submit comment/correction][What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
| |
| |
| | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
| | Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250. |
|
|
| |
| TGCGTCTTACAACTTCGTGG AGGCTGCTGTTAGTGGTGGT |
|
| |
| |