GrainGenes Probe Report: GBM1448
[Submit comment/correction][What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
| |
| |
| | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
| | Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250. |
|
|
| |
| GTATGACACCCGATCCATCC CAAAATTTGGGACCTGAGGA |
|
| 3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C |
|
| |
| |
| |
| |
| |