Query (optional)   in Class  

GrainGenes Probe Report: GDM111

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM111  [ Marker Report ]
Locus
Xgdm111-1D
Xgdm111
gdm111
General Remarks
Repeat sequence: (CA)13
Type
PCR
SSR
PCR primers
Left CACTCACCCCAAACCAAAGT
Right GATGCAATCGGGTCGTTAGT
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii