Query (optional)   in Class  

GrainGenes Probe Report: GDM138

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
GDM138  [ Marker Report ]
Locus
Xgdm138-5D
[ Show all 6 ]
General Remarks
Repeat sequence: (CT)44 imp.
Type
PCR
SSR
PCR primers
Left CATGAGCCGATTCAGCG
Right CGCTTAAATTGAAGTACCGC
Amplification Conditions
Tm = 50 C
Source Species
Aegilops tauschii

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.