Query (optional)   in Class  

GrainGenes Probe Report: GDM33

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM33  [ Marker Report ]
Locus
Xgdm33-1D
[ Show all 8 ]
General Remarks
Repeat sequence: (CA)20
Repeat sequence: (CA)21
Type
PCR
SSR
PCR primers
Left GGCTCAATTCAACCGTTCTT
Right TACGTTCTGGTGGCTGCTC
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii