Query (optional)   in Class  

GrainGenes Probe Report: GDM35

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM35  [ Marker Report ]
Locus
Xgdm35-2D
Lr39
General Remarks
Repeat sequence: (CA)26
Type
PCR
SSR
PCR primers
Left CCTGCTCTGCCCTAGATACG
Right ATGTGAATGTGATGCATGCA
Amplification Conditions
Tm = 55 C
Source Species
Aegilops tauschii