Query (optional)   in Class  

GrainGenes Probe Report: GDM72

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM72  [ Marker Report ]
Locus
Xgdm72-3D
gdm72-3D
Xgdm72
General Remarks
Repeat sequence: (CT)25 imp.
Type
PCR
SSR
PCR primers
Left TGGTTTTCTCGAGCATTCAA
Right TGCAACGATGAAGACCAGAA
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii