Query (optional)   in Class  

GrainGenes Probe Report: GDM99

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM99  [ Marker Report ]
Locus
Xgdm99-5D
[ Show all 9 ]
General Remarks
Repeat sequence: (GA)15
Type
PCR
SSR
PCR primers
Left AGGTTGTCCACTGCCTGTTC
Right ATGTCGTCCTCGTCTCATCC
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii