Query (optional)   in Class  

GrainGenes Probe Report: GIRP

[ Printable Version ]  [ Submit comment/correction ]

Probe
GIRP
Synonym
Other nameJ02817
Reference
ReferenceBaulcombe DC et al. (1987) A gibberellin response wheat gene has homology to yeast carboxypeptidase Y. Journal of Biological Chemistry 262:13726-13735.
General Remarks
Primers designed from wheat gibberellin responsive protein gene.
Type
PCR
STS
PCR primers
R:GGTGAGCAAAGCATCCGGTT
L:GCTCCTCCTGCTCGCGCTCT
Amplification Conditions
Anneal at 50oC.
Sequence
J02817
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Source Tissue
aleurone
PCR size
0.724
Data Source
Talbert, Luther E.97.01