Query (optional)   in Class  

GrainGenes Probe Report: GLU Bx

[ Printable Version ]  [ Submit comment/correction ]

Probe
GLU Bx
Reference
ReferenceD'Ovidio R et al. (1995) Development of a set of oligonucleotide primers specific for genes at the Glu-1 locus. Theoretical and Applied Genetics 91:189-194.
ReferenceD'Ovidio R et al. (1994) PCR analysis of genes encoding allelic variants of high-molecular-weight glutenin subunits at the Glu-D1 locus. Theoretical and Applied Genetics 88:175-180.
Type
PCR
STS
PCR primers
ATGGCTAAGCGCCTGGTCCT
TGCCTGGTCGACAATGCGTCGCTG
Specificity
Specific for High molecular weight (HMW) glutenin genes.
Source Gene Class
Glutenins
Source Gene
Glu-B1 (Triticum)
Source Allele
Glu-B1a (Triticum)
[ Show all 48 ]
Source Species
Triticum aestivum
Clone Authority
D'Ovidio, Renato
Data Source
D'Ovidio, Renato95.12.18