Query (optional)   in Class  

GrainGenes Probe Report: GMS021

[ Printable Version ]  [ Submit comment/correction ]

Probe
GMS021  [ Marker Report ]
Locus
GMS021
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceStruss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Type
SSR
PCR primers
CTATCACACGACGCAACATG
CCTGAGAAAGAAAGCGCAAC