Query (optional)   in Class  

GrainGenes Probe Report: GMS21

[ Printable Version ]  [ Submit comment/correction ]

Probe
GMS21  [ Marker Report ]
Locus
GMS0021
GMS021
GMS21
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceStruss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks
Annealing temperature = 55 deg C
Insert contains repeat (ga)17(ga)7
Type
SSR
PCR primers
5' CTATCACACGACGCAACATG
5' CCTGAGAAAGAAAGCGCAAC
CTATCACACGACGCAACATG
CCTGAGAAAGAAAGCGCAAC
SSR size
169