Query (optional)   in Class  

GrainGenes Probe Report: GMS61

[ Printable Version ]  [ Submit comment/correction ]

Probe
GMS61  [ Marker Report ]
Locus
GMS0061
GMS061
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceStruss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks
Annealing temperature = 60 deg C
Insert contains repeat (ga)16
Type
SSR
PCR primers
5' CACCTGTTCCGTCCCGTC
5' AACCTCTTTTTTATCCCTCGC
CACCTGTTCCGTCCCGTC
AACCTCTTTTTTATCCCTCGC
Forward CACCTGTTCCGTCCCGTC
Reverse AACCTCTTTTTTATCCCTCGC
SSR size
145