Query (optional)   in Class  

GrainGenes Probe Report: GPW1034

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW1034  [ Marker Report ]
Locus
Xgpw1034-6D
Xgpw1034
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CTG)18
Type
PCR
SSR
PCR primers
Forward TCGCCTGCCTAGTAAGCATT
Reverse TATCCCGTTGCAAGCTATCC
SSR size
Expected 233
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Aegilops speltoides
Triticum aestivum
Data Source
Sourdille, Pierre2009.09