Query (optional)   in Class  

GrainGenes Probe Report: GPW1082

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW1082  [ Marker Report ]
Locus
Xgpw1082-5B
Xgpw1082
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CA)17
Type
PCR
SSR
PCR primers
Forward GGGGCTAATCTGACCATCAA
Reverse CACCATCACCATGGAACAAG
SSR size
Expected 185
Amplification Conditions
Tm = 60C
Linkage Group
5B
Source Species
Aegilops speltoides
Triticum aestivum
Data Source
Sourdille, Pierre2009.09