Query (optional)   in Class  

GrainGenes Probe Report: GPW1146

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW1146  [ Marker Report ]
Locus
Xgpw1146-3B
Xgpw1146-3D
Xgpw1146a
Xgpw1146b
gpw1146
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CT)22
Type
PCR
SSR
PCR primers
Forward CCACCTCCGTCTTCGAGTAG
Reverse GGGAAGGAGAGATGGGAAAC
SSR size
Expected 243
Amplification Conditions
Tm = 60C
Linkage Group
3B/3D
Source Species
Aegilops speltoides
Triticum aestivum
Data Source
Sourdille, Pierre2009.09