Query (optional)   in Class  

GrainGenes Probe Report: GPW2243

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW2243  [ Marker Report ]
Locus
Xgpw2243-5A
Xgpw2243-5B
Xgpw2243a
gpw2243
gpw2243-5A
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (TG)31
Type
PCR
SSR
PCR primers
Forward GGGCAATCTGTTGGATCTGT
Reverse CCACTTCGCTGCTGATGTAA
SSR size
Expected 197
Amplification Conditions
Tm = 60C
Linkage Group
5B/5A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09