Query (optional)   in Class  

GrainGenes Probe Report: GPW2264

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW2264  [ Marker Report ]
Locus
Xgpw2264-7A
Xgpw2264
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GT)16
Type
PCR
SSR
PCR primers
Forward TTGCTTTCCCAAATTGTGCT
Reverse GGCATTGAGAATCCAAGCAT
SSR size
Expected 299
Amplification Conditions
Tm = 60C
Linkage Group
7A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09