Query (optional)   in Class  

GrainGenes Probe Report: GPW2266

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW2266  [ Marker Report ]
Locus
Xgpw2266-3A
Xgpw2266
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CA)16
Type
PCR
SSR
PCR primers
Forward TTTTTGCCCACACGGC
Reverse CGTGGAGGTGTCGACCTAAT
SSR size
Expected 231
Amplification Conditions
Tm = 60C
Linkage Group
3A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09