Query (optional)   in Class  

GrainGenes Probe Report: GPW2333

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW2333  [ Marker Report ]
Locus
Xgpw2333-2B
Xgpw2333-7A
General Remarks
Motif (CA)21
Type
PCR
SSR
PCR primers
Forward ACAAGCCCAAAAGACACACA
Reverse ACATCACTTCCTCCGGTTTG
SSR size
Expected 227
Amplification Conditions
Tm = 60C
Linkage Group
2B
Source Species
Triticum monococcum
Data Source
Sourdille, Pierre2009.09