Query (optional)   in Class  

GrainGenes Probe Report: GPW297

Probe
GPW297  [ Marker Report ]
Locus
Xgpw297-3D
Xgpw297a
Xgpw297b
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GA)33
Type
PCR
SSR
PCR primers
Forward TCCAACTCTCGTTTGAACTACT
Reverse CTTTGTCACCCATGACCTGC
SSR size
Expected 216
Amplification Conditions
Tm = 60C
Linkage Group
unlinked/3D
Source Species
Aegilops tauschii
Triticum aestivum
Data Source
Sourdille, Pierre2009.09