Query (optional)   in Class  

GrainGenes Probe Report: GPW311

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW311  [ Marker Report ]
Locus
Xgpw311-4B
[ Show all 6 ]
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GA)25
Type
PCR
SSR
PCR primers
Forward CACTAGACGTTTGGCTTGCT
Reverse GACCTTCCCAACCCGTAGAC
SSR size
Expected 178
Amplification Conditions
Tm = 60C
Linkage Group
4D/4B
Source Species
Aegilops tauschii
Triticum aestivum
Data Source
Sourdille, Pierre2009.09