Query (optional)   in Class  

GrainGenes Probe Report: GPW3140

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW3140  [ Marker Report ]
Locus
Xgpw3140-7A
General Remarks
Motif (GA)14.5(AG)8(GA)22.5
Type
PCR
SSR
PCR primers
Forward GGTGGAGAGAAAGATGGATACG
Forward GGTGGAGAGAAAGATGGATACG
Reverse TCCTAAGAGAGATGCGGGC
Reverse TCCTAAGAGAGATGCGGGC
SSR size
Expected 215
Amplification Conditions
Tm = 60C
Linkage Group
7A
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09