Query (optional)   in Class  

GrainGenes Probe Report: GPW3241

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW3241  [ Marker Report ]
Locus
Xgpw3241-6B
gpw3241
gpw3241-6B
General Remarks
Motif (GA)34.5
Type
PCR
SSR
PCR primers
Forward ATATAGGATTGGTGGGTCAACG
Reverse CAAATTCACATCCACTCCCC
SSR size
Expected 324
Amplification Conditions
Tm = 60C
Linkage Group
6B
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09