Query (optional)   in Class  

GrainGenes Probe Report: GPW3241

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
GPW3241  [ Marker Report ]
Locus
Xgpw3241-6B
gpw3241
gpw3241-6B
General Remarks
Motif (GA)34.5
Type
PCR
SSR
PCR primers
Forward ATATAGGATTGGTGGGTCAACG
Reverse CAAATTCACATCCACTCCCC
SSR size
Expected 324
Amplification Conditions
Tm = 60C
Linkage Group
6B
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.