Query (optional)   in Class  

GrainGenes Probe Report: GPW4071

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4071  [ Marker Report ]
Locus
Xgpw4071-1A
Xgpw4071-6B
General Remarks
Motif (CT)38.5
Type
PCR
SSR
PCR primers
Forward CCAGTTAGTTGTGGCCCAGT
Reverse TGGAGGAAGGCGTAGTCG
SSR size
Expected 306
Amplification Conditions
Tm = 60C
Linkage Group
1A/6B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09