Query (optional)   in Class  

GrainGenes Probe Report: GPW4085

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4085  [ Marker Report ]
Locus
Xgpw4085-2B
Xgpw4085-2D
General Remarks
Motif (TC)23.5
Type
PCR
SSR
PCR primers
Forward GTGACAAGTAGACCTAGCAA
Forward GTGACAAGTAGACCTAGCAA
Reverse ACACATATACGGTTACACCT
Reverse ACACATATACGGTTACACCT
SSR size
Expected 189
Amplification Conditions
Tm = 60C
Linkage Group
2B/2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09